WWW.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА

 

Pages:     | 1 |   ...   | 18 | 19 || 21 |

«Российская академия сельскохозяйственных наук Всероссийский научно-исследовательский институт защиты растений Российской академии сельскохозяйственных наук ...»

-- [ Страница 20 ] --

инфекции явились зараженные семена, завезен- Среди указанных болезней в настоящее время ные из бывшей Югославии, США и других стран. наиболее распространенными и вредоносными В настоящее время фомопсис проявляется в боль- являются белая гниль, ложная мучнистая роса, шинстве регионов страны, где возделывается серая гниль, фомопсис, а в отдельных регионах подсолнечник. Сейчас он является одной из вре- страны — пепельная гниль. Против этих болез доносных болезней. Выявлены отдельные фун- ней необходимо постоянно проводить комплекс гициды, несколько ограничивающие семенную защитных мероприятий, который одновремен и аэрогенную инфекцию возбудителя болезни. но позволяет ограничить и другие болезни. Это Создание устойчивого к фомопсису сортимента менее вредоносные альтернариоз, фомоз, сухая подсолнечника до настоящего времени пока оста- гниль корзинок, фузариоз, вертициллезный вилт, ется проблемным. Постоянная внутривидовая ржавчина, настоящая мучнистая роса, потери изменчивость возбудителя ложной мучнистой урожая от которых пока не превышают 25%. Воз росы привела к нарастанию вредоносности бо- можно, что через какое-то время, последняя груп лезни. В популяциях патогена выявлен ряд фи- па болезней может осложнить фитосанитарную зиологических рас, отдельные из которых имеют обстановку на посевах подсолнечника в стране.

решающее значение в селекции устойчивости В последнее время была предложена усовер подсолнечника к болезни. Происходит постоян- шенствованная система защиты подсолнечни ное расширение ареала вредоносной болезни под- ка на основе мониторинга, прогноза болезней солнечника — пепельной гнили. Кроме Поволжья и экономической оценки комплекса мероприятий, и Северного Кавказа в настоящее время нарастает сложившихся в настоящее время в агропромыш ее распространенность в Черноземье. В недавнее ленном комплексе страны (Якуткин и др., 2011).

время избыточное насыщение подсолнечником Исследования показали, что рентабельность привело к резкому нарастанию вредоносности за- применения указанной системы в защите подсо разихи в Ростовской области. лнечника может превышать 340%. Дальнейшее В настоящее время распространенными гриб- совершенствование эффективной защиты под ными болезнями подсолнечника в России явля- солнечника, как важнейшей продовольственной, ются: белая гниль (Sclerotinia sclerotiorum (Lib.) кормовой культуры и будущего источника аль De Bary), ложная мучнистая роса (Plasmopara тернативной энергии, зависит от использования halstedii (Farl.) Berl. et de Toni), серая гниль нового, устойчивого к болезням и заразихе сорти (Botryotiniafuckeliana (de Bary) Whet.), рак стеблей мента, а также современных эффективных и без или фомопсис (Diaporthe helianthi Munt. Cvet.), опасных фунгицидов против данных вредных альтернариоз (Alternaria helianthi (Hansf.) Tubaki объектов. Решение этой задачи пока остается про and Nishihura) и другие виды Alternaria spp., фо- блемной в нашей стране.

моз (Leptosphaeria lindquistii Frezzi), вертициллез Литература Агроатлас полезных растений и вредных организмов: 2008. http://www. agroatlas.ru Бейлин И. Г. Ржавчина подсолнечника в прошлом и настоящем. Воронеж, 1928.

Бейлин И. Г. Заразиха и меры борьбы с нею. Воронеж, Коммуна, 1930.

Лобик А. Ю. Болезни подсолнечника и меры борьбы с ними. М., Сельхозгиз, 1931.

Подсолнечник. (Монография). Под общей редакцией В. С. Пустовойта. М. «Колос», 1975, 592 с.

Ямалеев А. М., Хасанова Д. В., Набиева Р. А. Исследование биологической эффективности пропаргиламинов и обоснование их роли в индуцировании реакций устойчивости пшеницы к грибным болезням.

Стебут А. И. Подсолнечник и заразиха. 1916.

Жданов Л. А. Об иммунитете подсолнечника к заразихе. Ж. «Маслобойно — жировое дело», 1928, № 8, с. 30.

Новотельнова Н. С. Ложная мучнистая роса подсолнечника. М.-Л., Наука, 1966, 150 с.

Целле М. А. Болезни подсолнечника. Л.,УСУ ОБВ, 1932, 33 с.

Якуткин В. И. Идентификация возбудителя фомопсиса подсолнечника и методы его учета.

Методические указания. ВАСХНИЛ, ВИЗР, Л., 1991, 19 с.

Якуткин В. И., Таволжанский Н. П., Гончаров Н. Р. Защита подсолнечника от болезней. //Защита и каран тин растений, № 3, 2011, 70–91 с.

Ячевский А. А. Справочник фитопатологических наблюдений. Л., ВАСХНИЛ, 1929, 237 с.

HISTORY OF INVESTIGATIONS

OF SUNFLOWER DISEASES IN RUSSIA

Introduction and further expansion of sunflower in Russia led to affection at the numerous diseases and broomrape.

The basis of their regular investigation in the country was laid by A. A. Jaczewski. Later the studies were carried out on concrete biological features of many pathogens and broomrape, identification new diseases, mapping and identification of different zones of their damage in the area of culture, developing monitoring and forecasting for optimizing the measure control against the most damaging sunflower diseases with the economic evaluation of effectiveness.

Key words: sunflower, diseases, history, Russia.

ИССЛЕДОВАНИЕ БИОЛОГИЧЕСКОЙ ЭФФЕКТИВНОСТИ

ПРОПАРГИЛАМИНОВ И ОБОСНОВАНИЕ ИХ РОЛИ

В ИНДУЦИРОВАНИИ РЕАКЦИЙ УСТОЙЧИВОСТИ

ПШЕНИЦЫ К ГРИБНЫМ БОЛЕЗНЯМ

Обоснована роль пропаргиламинов в индуцировании реакций устойчивости пшеницы путем активации экспрессии генома. Показано, что они обеспечивают устойчивость растений пшени цы к грибным болезням не только прямым путем, а и через влияние на другие защитные систе мы, такие как активность лектинов, система пероксидазы, хлорофилл-белковые комплексы, и по механизму действия являются активаторами не только болезнеустойчивости, но и продуктивно сти растений.

Ключевые слова: пропаргиламины, хлорофилл-белковый комплекс, лектин, фитопатоген, пшени ца, белок, фунгицид.

В системе защиты растений от грибных бо- ления работ по поиску веществ с защитными лезней перспективным направлением рассма- свойствами не биоцидной природы (Тютерев, триваются прогрессивные технологии создания 2002). Важно знать, как реализуются потенци и использования менее опасных препаратов с не альные возможности действующих веществ при биоцидной активностью (Захаренко, 2008). Ре- различных грибных заболеваниях, чтобы на их зультаты исследований по иммунитету растений основе создавать биофунгициды не биоцидной к фитопатогенам позволяют определить направ- природы (Комплексная защита…, 2001).

Однако есть еще достаточно много неясных листьев и в фазе кущение-трубкования. Резуль моментов по физиологическим функциям био- таты исследования позволили выявить высокую фунгицидов. Исходя из потенциальной гормо- биологическую эффективность (60,2%) синтези нальной активности пропаргиламинов, необходи- рованных пропаргиламинов, проявившуюся в су мо было изучить биологическую эффективность щественном подавлении развития возбудителей к инфекционным грибным заболеваниям с целью корневых гнилей. Это говорит о том, что одной дальнейшего практического применения их для из важных составляющих биологической актив Цель настоящей работы — выявить биологи- ная активность. Представляет большой интерес ческую эффективность и физиолого-биохимиче- использование антигрибной активности пропар ские механизмы действия пропаргиламинов на гиламинов при разработке пропаргиламинсо растения пшеницы при использовании их в каче- держащих препаратов в биологической защите стве неспецифического протектанта. пшеницы от корневых гнилей и листостебельных Результаты исследований. Следует отметить, грибных болезней.

что фунгицидные свойства фитоадаптогенов по- Молекулярные механизмы, обусловившие лифункциональны и заключаются в усилении фи- данный эффект, несомненно, носят гетерогенный зиологических защитных функций растительного характер. В нем, однозначно, участвуют множе организма в норме и патологии (Van Loon, 1985). ство факторов, и полученные данные позволяют Пропаргиламины усиливают адаптацию растений раскрыть некоторые из них. Так, было выяснено, к стрессовым факторам, связанных с напряжени- что эти соединения довольно значительно повы ем физиологических функций к болезням. Физио- шают содержание аскорбиновой кислоты в рас логическое действие их в растительном организме тениях. Данный эффект обусловлен влиянием имеет комбинированный характер и складывает- препарата на содержание аскорбата в растении на ся из их догеномного (фунгицидного) и геномно- уровне его синтеза. Для свободной аскорбиновой го влияния на синтетические процессы в клетках. кислоты характерны как положительное влияние Механизмы индуцирования устойчивости, рас- на рост, так и участие в защитных реакциях. Учи сматриваемые на молекулярном уровне, протека- тывая то, что для синтеза аскорбиновой кислоты ют с участием многих соединений. одним из важнейших условий является состояние Вещества — индукторы устойчивости про- хлорофилл-белкового комплекса, следует принять тив факультативных патогенов, какими являются во внимание, что пропаргиламины весьма поло возбудители корневых гнилей пшеницы, наряду жительно влияют на абсорбцию света (Ab, %) ХБК.

с усилением биогенеза веществ вторичного про- Проведенные исследования по содержанию исхождения, повышают в растении и основной хлорофилла, измеренного путем абсорбции ли обмен, то есть повышают выносливость расте- стьями лазерного излучения, показали возмож ний к деструктивным воздействиям патогена. ность определения уровня болезнеустойчивости.

Поэтому представляло интерес исследовать ан- Выявлено, что иммуностимуляторы и регулято тигрибную активность пропаргиламинов и их ры роста и развития растений уменьшают диф производных в связи с разработкой препаратов фузное отражение листьев;

при этом происходит для биологизированной защиты пшеницы, как снижение показателей лучей, прошедших сквозь от факультативных, так и от облигатных грибных листовую пластинку, увеличивается коэффици Как видно из таблицы 1, предпосевная обра- лазерного излучения и снижается развитие листо ботка семян пропаргиламином в концентрации вых болезней. Коэффициент диффузного отраже 0,01% заметно повышала силу роста. Таким обра- ния показывает изменение постоянства внутрен зом, пропаргиламин в более низких концентраци- ней структуры листа (Lisker, 1994).

ях обладает более выраженным ростостимулиру- Важным свойством пропаргиламинов явля Иммуностимулирующий показатель опреде- гемагглютинирующую активность лектинов ХБК, лялся в двух возрастных группах — в фазе двух которые играют немаловажную роль в защитных Таблица 1. Биологическая эффективность по подавлению корневых гнилей и ростстимулирующее действие пропаргиламина на яровой пшенице Ямалеев А. М., Хасанова Д. В., Набиева Р. А. Исследование биологической эффективности пропаргиламинов и обоснование их роли в индуцировании реакций устойчивости пшеницы к грибным болезням.

реакциях растений к грибным болезням. Про- Таким образом, характерной особенностью никая через плазматическую мембрану внутрь пропаргиламинов является их способность сти клетки, пропаргиламины, возможно, выступают мулировать рост и развитие растений в исключи в качестве регуляторов транскрипции генов лекти- тельно низких концентрациях, повышать устой нов, образуя с соответствующими белками-рецеп- чивость к стрессовым условиям произрастания.

торами сложные комплексы, способные достигать При анализе полученных результатов доста участков хроматина в ядре. Например, по мере точно четко выявляется связь между использу развития ржавчинной инфекции, в листьях на- емой концентрацией применяемых соединений блюдается продолжение повышения лектиновой и их физиологическим эффектом, а также фи активности в ответ на постинфекционный про- зиологическим состоянием растения. На основе цесс в организме. Снижение активности лектинов проведенных испытаний можно сделать вывод находится во взаимосвязи с уровнем разрушения о том, что пропаргиламины обеспечивают устой листа, который, в свою очередь, отражает уровень чивость растений не только прямым путем, но структурных изменений хлорофилл-белковых и через влияние на другие защитные системы, комплексов под влиянием инфекционных струк- такие как активность лектинов, система перокси тур гриба. В листьях, пораженных ржавчиной, на- дазы, аскорбиновой кислоты и белка, т. е. анализ ступает депрессия в синтезе хлорофилла и белка, позволил выявить наиболее информативные био усиливается деградация белка. Усиление активно- химические критерии оценки ранних изменений сти молекулярных конструкций пропаргиламинов в растительном организме при действии пропар может быть достигнуто введением дополнитель- гиламинов. Полученные данные свидетельствуют ных областей трансактивации. Подходящие обла- о перспективности применения пропаргиламин сти активации подбираются из известных в приро- содержащих препаратов для снижения разви де источников, например, из участков активации тия и распространения грибных фитопатогенов, факторов транскрипции вирусов, грибов, стрессо- а также для снижении фитотоксичности фунги вых белков растений (шоковые белки, лектины). цидов при их совместном использовании.

Литература Захаренко В. А. Новые технологии поиска, испытаний, создания и внесения средств защиты растений не биоцидной природы. М., 2008, 89 с.

Комплексная защита зерновых культур от болезней, вредителей и сорняков в Республике Башкортостан.

Уфа: БНИИСХ, 2001, 68 с.

Тютерев С. Л. Научные основы индуцированной болезнеустойчивости растений / Санкт-Петербург, 2002, 328 с.

Lisker J. S. New physical methods and system for avtomatic determination of state of plant and seeds // Automatic control of food and biological processes. Paris: Elsevier, 1994, р. 75–82.

Van Loon L. G. Pathogenesis-related proteins // Plant Molec. Biol., 1985, v. 4, n. 1, p. 111–116.

BIOLOGICAL EFFECTIVENESS PROPARGILAMINS

AND SUBSTANTIATION OF THEIR ROLE IN THE INDUCTION

OF RESISTANCE REACTIONS OF WHEAT TO FUNGAL DISEASES

Biological efficiency propargilamins to fungal diseases of wheat is investigated and their role in induction reactions of stability by activation genome expression is proved;

it is found out, that they provide stability of plants not only to straight lines by, but through influence on other protective systems, such as activity lectins, peroxidase system, a chlorophyll-protein complexes and on the mechanism of action are activators not only disease-resistant, but also efficiency of plants.

Key words: propargilamins, a chlorophyll- protein complex, lectin, wheat, protein, fungicide.

ECOLOGICALLY SAFE METHOD FOR PLANT PROTECTION

BY BIOTIC ELICITORS DERIVED

FROM PLANT PATHOGENIC FUNGI

Our long-term goal is to provide alternative plant resistance based upon stimulation by biotic elicitors of the plant’s own defenses against diseases. The elicitors, molecular signals activating defense responses in plants, are low molecular weight products released by the invading pathogen or the plant or both. At least two groups of elicitors were found in fungi Fusarium solani (Mart.) Sacc. and Botrytis allii Munn mycelium extract, which differ in composition, molecular mass and inducing activity. Phytoalexin accumulation served as marker of resistance reactions increased after application of very low concentrations of the elicitor. The results of 2-year field trials demonstrated that foliar spraying of onion plants with biotic elicitors before artificial inoculation with peronosporosis agent significantly reduced the spread and extent of disease development.

Key words: Necrotrophic fungi, biotic elicitors, Allium cepa L., phytoalexins, induced resistance.

Fungal pathogens are major agricultural was to obtain and analyze biotic elicitors from B. allii pathogens worldwide. Currently, chemical control and F. solani and to use them to develop method of involves environmentally damaging and expensive induced disease resistance in onion.

fungicides. Breeding for resistance has been largely To find biotic elicitors among the metabolites of ineffective (Дьяков и др., 2001). Therefore new B. allii we analyzed first the phytoalexin-inducing alternative methods for plant protection are activity of growth medium, spore suspension and necessary which would allow, first, to receive higher cytoplasmic content of the mycelium.

protective effect at minimal number of chemical The analysis of inducing ability of culture treatments, but also to limit development on new filtrate by drop diffusate technique revealed that virulent races. These new methods are necessary to phytoalexin synthesis in drop diffusates after receive ecologically pure production and to improve treatment by protein and carbohydrates fractions of an environment. One of such new method is one, culture filtrate is higher than after addition of B. allii which based not on inhibition of plant pathogens, spores or culture filtrate. Highest induced activity but on increasing their innate immunity to harmful has protein fraction, which was obtained from the organisms, so called «induced disease resistance» or pathogen growth medium by sedimentation of «systemic acquired resistance». The biotic elicitors do proteins with ammonium sulfate (80-100%). Tcibulin not themselves kill the fungus but stimulate plant’s 1d accumulation after treatment by this fraction was own defenses against pathogen attack and assures 13-fold higher than after B. allii spores themselves healthy plant growth (Озерецковская, 1994;

Дми- and 2,7-fold higher in comparison with treatment by The onion, as an object of immunological µg/ml). Tcibulin 2d amount was increased 25-fold and studies was of interest for us, at least for two 1,8-fold accordingly.

reasons. First, the absence of monogenic resistance in Allium cepa L. allows study of innate mechanisms for polygenic resistance. Second, large losses due to different onion diseases (up to 30%) increase the importance of the study. Early we discovered two onion phytoalexins and observed a correlation between the resistance of onion cells to infection and their ability to synthesize the phytoalexins.

We identified them as 1,3-dion-5-octyl-cyclopenta 1,3-dione (tcibulin 1d) and 5-hexyl-cyclopenta 1,3-dione (tcibulin 2d) and also shown that the phytoalexins could be served as markers of induced resistance in onion (Дмитриев, 1999).

Still the chemical identities of fungal metabolites that induce defense responses in cultured plants Figure. Purification of extract of the mycelium of B. allii by gel remains poorly understand. The aim of present work Dmitriev A. P., Perkovska G. Y., Dyachenko A. I.

Ecologically safe method for plant protection by biotic elicitors derived from plant pathogenic fungi.

The substances, which caused tcibulins 1d and carbohydrates localized in the cytoplasmic content 2d accumulation in drop diffusates, were found in of fungal mycelium had the highest phytoalexin the cytoplasm of B. allii. Water and ethanol extracts inducing activity.

of B. allii mycelium (with boiling or without) in It was shown previously that non-specific different degree induced the phytoalexin activity pathogen F. solani induced accumulation of (data not shown). The most inducing activity had the fungitoxic compounds in onion tissues (Дмитриев, cytoplasmic fraction after extraction of mycelium by 1999). Therefore we have decided to find out defense Таble 1. Induction of fungitoxic activity of diffusates of A. cepa by fungal metabolites B. allii Two fractions were received and purified by revealed that concentration 0,025% caused only separation of dialyzed ethanol extract of fungal traces of phytoalexin synthesis. This concentration mycelium B. allii on Sephadex G-50 (Fig.). The of the biotic elicitor from F. solani was used for fraction 1 was eluted with volumes of 60-100 ml and plant immunization in field trials. Practicability represented of with Lowry-positive compounds. This of the increased disease resistance in onion after fraction induced the synthesis of tcibulins 1d and its treatment with the water extract from F. solani 2d in concentration 100 µg/ml 2-fold higher than in mycelium (0,025%) has been shown (Tab. 2). It has control with B. allii spores. The fraction 2 (oligosaccarides) was collected with Таble 2. Effect of biotic elicitor from F. solani on inhibition of disease elution volumes 110-150 ml and kept symptoms in onion plants after artificial infection by P. destructor carbohydrates. Oligosaccarides fraction proteinaceous one. In concentration 100 µg/ml glucose equivalents invoked the accumulation of tcibuins 1d and confirmed the carbohydrate nature.

Thus, at least two groups of biotic elicitors from B. allii have been found which differ in composition, molecular fraction from culture filtrate and been established that spraying of growing plants by Thus, for the first time the biotic elicitors were elicitor solution 2 days before artificial inoculation isolated from metabolites of plant pathogenic fungi with Peronospora destructor (Berk.) Casp. In Berk B. allii and F. solani. Two groups of biotic elicitors reduced the intensity of disease development in all capable to induce defense responses in A. cepa were It was demonstrated that the biotic elicitor composition, molecular weight and biological activity.

derived from B. allii was highly effective to prevent The main advantage of the biotic elicitors is that their onion losses during storage. Foliar spraying of onion action is directed not on inhibition of pathogen, but plants by the elicitor solutions from B. allii (0,005- on activation of innate resistance mechanisms of 0,05% mycelium extract) 2 weeks before harvesting plants in analogous manner, as it occurs in nature.

significantly reduced the disease development and The effectiveness of the developed method has suppressed the bulbs sprouting. After 5 months of received a confirmation in field trials, which were storage at +4oC the quantity of decayed and sprouting carried out for three years together with Kharkov’s bulbs has been decreased twice as compared to control. Institute of Vegetables and Melon Growing, Ministry Weight losses of bulbs from elicitor-treated plants of Agriculture of Ukraine and Skvira’s Research have been decreased on 1,8-2,3% to the control. This Selection Station. A number of elicitor preparations inhibition of disease symptoms was correlated with have been developed and biotechnology of their an increased content of abscisic acid in the bulbs (data application is in progress.

not shown).

References Дмитриев А. П. Фитоалексины и их роль в устойчивости растений. Киев. Наук. думка, 1999, 207 с.

Дмитриев А. П., Полищук В. П., Гродзинский Д. М. Индуцирование системной устойчивости у растений.

Вестник Харьковского нац. аграрн. ун-та. Сер. Биология, 2005, 6, с. 19-27.

Дьяков Ю. Т., Озерецковская O. JL, Джавахия В. Г., Багирова С. Ф. Общая и молекулярная фитопатология. М.

Изд-во Общества фитопатологов, 2001, 302 с.

Озерецковская О. Л. Индуцирование устойчивости растений биогенными элиситорами фитопатогенов.

Прикл. биохим. и микробиол., 1994, 30, 5, с. 325-339.

МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ ПОДХОД

В ИДЕНТИФИКАЦИИ ПАТОГЕННЫХ ГРИБОВ

НА МАЛИНЕ

В представленной статье представлены материалы научно-исследовательских работ по молеку лярно-генетической идентификации патогенов, вызывающих различные микозные заболевания у растений малины. Показано, что высокую надежность в видоспецифицной идентификации грибных патогенов обеспечивает использование участка кластера рибосомной ДНК.

Ключевые слова: малина, патогены, IST-region.

Успешному решению актуальных проблем способствует получению объективной и полной, садоводства, связанных с созданием высокопро- а главное, своевременной информации о состоя дуктивных сортов и поддержанием их на высоком нии фитосанитарной ситуации, которая должна продукционном уровне, способствует изучение характеризовать как количественный, так и каче популяционных особенностей возбудителей ми- ственный состав популяции вредных организмов.

козов, что позволяет оптимизировать управление Постоянно изменяющиеся климатические ус агроценозом в целом. Реализации такого подхода ловия в большей мере подвергают растения дей Girichev V.S., Flachowsky H., Hanke M.-V.

Молекулярно-генетический подход в идентификации патогенных грибов на малине.

ствию стрессовых факторов и, как следствие этого, Первоначально нами выделялись грибы из по растения становятся более восприимчивыми к по- врежденных стеблей малины в чистую культуру, ко вреждениям вредными организмами и болезнями. торые культивировались на среде Czapek DOX AGAR Основным методом осуществления контроля (Duchefa, Biochemie) при температуре +24°C в усло фитопатогенной ситуации в агроценозах является виях климакамеры при постоянном освещении.

высокоспецифичная и эффективная диагностика Изолирование суммарной клеточной ДНК Традиционные методы диагностики патоге- Kit (Qiagen) в соответствии с протоколом изгото нов заключаются, в основном, в визуальной оцен- вителя.

ке болезней по симптоматике, однако при таком ПЦР проводили с использованием прямого подходе не всегда возможно с высокой долей веро- праймера ITS 1 (5' TCC GTA GGT GAA CCT GCG ятности выявить вызбудителя заболевания. G '3) и обратного ITS 4 (5' TCC TCC GCT TAT TGA Диагностику также часто затрудняет большое TAT GC '3) (White et al., 1990).

разнообразие и быстрое появление новых рас па- Для клонирования ПЦР-фрагментов гриба тогенов, которые нередко дают нехарактерные мы использовали систему TOPO TA Cloning Kit Молекулярно-генетические методы на совре- Очистку ПЦР-фрагментов от посторонних менном этапе развития науки способны обеспечить примесей проводили с применением набора реак высокую универсальность, относительную просто- тивов MinElute® PCR Purification (Qiagen).

ту и высокое качество идентификации патогенов. Выделение плазмида осуществляли с исполь Высокую результативность в исследованиях зованием набора GeneJET Plasmid Miniprep Kit по идентификации грибных патогенов и успеш- (Fermentas).

ное его применение в качестве удобного инстру- Прямое секвенирование нуклеотидных после мента для понимания закономерностей эволю- довательностей межгенного ITS региона проводи ционного процесса у эукариот находят работы лось в Eurofins MWG Operon (Ebersberg).

по использованию участка кластера рибосом- Биоинформационный анализ данных и поиск ной ДНК (internal transcribed spacer, ITS-region) гомологических нуклеотидных последователь (Forterre, 1999;

Hillis, 1991, 1996). ностей проводили в открытой базе генетических Материалы, методы и результаты исследований. данных GenBank (http://www. ncbi. nlm. nih. gov).

Исследования проводились в Julius Khn-Institut Детекцию результатов экстракции ДНК про (JKI) — Вundesforschungsinstitut fr Kulturpflanzen, водили при помощи спектрофотометра NanoDrop Institut fr Zchtungsforschung an gartenbaulichen 2000с.

Kulturen und Obst (г. Дрезден, Германия). В результате молекулярно-генетических иссле Растительный материал сортов мали- дований, на основе сравнительной оценки секвен ны: Lumina, Malling Promise, Tulameen, Lucana, сов полученных грибов с базовыми, выявлен видо Willamette, используемый для отбора проб, брал- вой состав грибов, преобладающий на растениях Таблица 1. Видовой состав грибов, полученных с пораженных частей

TCCGTAGGTGAACCTGCGGAGGGATCATTGCTGGAACGCGCCCCAGGCGCACCCAGAAAC

CCTTTGTGAACTTATACCTTACTGTTGCCTCGGCGCTAGCTGGTCCTTCGGGGCCCCT

CACCCTCGGGTGTTGAGACAGCCCGCCGGCGGCCAACCCAACTCTTGTTTTTACACT

GAAACTCTGAGAATAAAACATAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTG

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAAT

Phomopsis sp.

CATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTTCGAGCGT

CATTTCAACCCTCAAGCCTGGCTTGGTGATGGGGCACTGCTTTTACCCAAGAGCAGGCCCT

GAAATTCAGTGGCGAGCTCGCCAGGACCCCGAGCGCAGTAGTTAAACCCTCGCTCTGGAAG

GCCCTGGCGATGCCCTGCCGTTAAACCCCCAACTTCTGAAAATTTGACCTCGGATCAGGTAG

GAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACAT

TCAGAAGTTGGGGTTTAACGGCGTGGCCGCGTCGATTACCAGTAACGATGTGTAAATTACTAC

GCTATGGAAGCTCGACGTGACCGCCAATCAATTTGGGGAGTGTTAACTAAAACAGCTCCCAA

CACCAAGCTGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACT

GGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACT

Fusarium sambucinum

TATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTT

GATTTATTTGTTTTTTTACTCAGAAGTTCCACTAAAAACAGAGTTTAGGGGTCCTGCGGCGGGC

CGTTCCGTGAGGAACGGGCTGATCCGCCGAGGCAACATAGAGGTATGTTCACAGGGGTTTGG

GAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTTCACCTACGA

TCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCG

GGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGG

GTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTA

ATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT

GCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGC

Alternaria alternata

CCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGT

GTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACT

GGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAG

CCTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATA

AGCGGAGGA

TTACTACGTTCAGAGATTGCTATAAATCCGCCGTTGAATTTGAGGAATGGCAGTAAAG

CCAGTTCCCAATACTAAGCTAGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGC

CCACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAAT

TCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTT

Truncatella angustata

GAAAGTTTTGACTTATTAAAATAAGACGCTCAGATTACTTAAAAATAACAAGAGTTTAGTAGTC

CACCGGCAGGCGCTACAGGGTAAGCCGTTCCCGGGTAGGTCGCTACAGAGTAGCTCGCTACAG

GGTAGGTTCGCCCAGCAACATCTGCCGAGGCAACAGTGGTAAGTTCACATGGGTTTGGGAGT

TAGAAACTCTGTAATGATCCCTCCGCAG

GAGGTCAGAGTGTAAAAATGTACTTTTGGACGTCGTCGTTCTGAGTGCAAAGCGCGAGATG

TACTGCGCTCCGAAATCAATACGCCGGCTGCCAATTGTTTTGAGGCGAGTCTACACGCAGAGG

CGAGACAAACACCCAACACCAAGCAGAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGC

CCCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAAT

Phoma sp. (Didymella applanata)

TCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTT

GAAAGTTGTAACTATTATGTTTTTTCAGACGCTGATTGCAACTGCAAATGGTTTAAATTGTC

CAATCGGCGGGCGAACCCGCCGAGGAAACGAAGGTACTCAAAAGACATGGGTAAGAGA

TAGCAGGCAAAGCCTACAACTCTAGGTAATGATCCT

GAGGTCAGAGTGTAAAAATGTACTTTTGGACGTCGTCGTTATGAGTGCAAAGCGCGAGATG

TACTGCGCTCCGAAATCAATACGCCGGCTGCCAATTGTTTTAAGGCGAGTCTACACGCAGAGG

CGAGACAAACACCCAACACCAAGCAGAGCTTGAAGGTACAAATGACGCTCGAACAGGCATGC

CCCATGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAAT

Epicoccum sp.

TCACACTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTT

GAAAGTTGTAACTATTATGTTTTTTCAGACGCTGATTGCAACTGCAAAGGGTTTGAATGTTGTC

CAATCGGCGGGCGGACCCGCCGAGGAAACGAAGGTACTCAAAAGACATGGGTAAGAGGTAG

CAGACCGAAGTCTACAAACTCTAGGTAATGATCCT

TCCGAGGTCACCTAGAANATAAAGGTTTCAGTCGGCAGAGTTCCTCTCCTTTGACAGAC

GTTCGAATAAATTCTACTACGCCTAAAGCCGGAGTGGCCTCGCCGAGGTCTTTAAGGCGCGC

CCAACTAAGGACGACGCCCAATACCAAGCATAGCTTGAGTGGTGTAATGACGCTCGAACAG

GCATGCCCCTCGGAATACCAAGGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAAT

TCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAACCAAGAGATC

Aureobasidium pullulans

CGTTGTTGAAAGTTTTGATTTATTCAAAATTTTAACTCAGACGACCGGTTAAATAACAA

GAGTTTGGTTTAACTCTGGCGGGCGCTCGCCTGGGACGAATCCCCAGCGGCTCGAGACCGAG

CGGTCCCGCCAAAGCAACAAGGTAGTTTTAACAACAAAGGGTTGGAGGTCGGGCGCTGAG

CACCCTTACTCTTTAATGATCCT

CCATAGAAAAATTTGGGTTTTGGCAGAAGCACACCGAGAACCTGTAACGAGAGATATTACTAC

GTTCAGGACCCAGCGGCGCCGCCACTGATTTTAGAGCCTGCCATTACTGACATAGACTCAATAC

CAAGCTAAGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAAGG

GGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCG

Botrytis sp.

CATTTCGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTAT

TATATAGTACTCAGACGACATTAATAAAAAGAGTTTTGGTATTCTCTGGCGAGCATACAAGGC

CCGAAGGCAGCTCGCCAAAGCAACAAAGTAATAATACACAAGGGTGGGAGGTCTACCCTTTCG

GGCATGAACTCTGTAATGATCCT

GAGGTCACATTCAGAAGTTGGGGTTTTACGGCATGGCCGCGCCGCGTTCCAGTTGCGAGGT

GTTAGCTACTACGCAATGGAGGCTGCAGCGAGACCGCCAATGTATTTCGGGGGCGGCACCG

CCAGAAGGCAGAGCCGATCCCCAACACCAAACCCGGGGGCTTGAGGGTTGAAATGACGCTC

GAACAGGCATGCCCGCCGGAATACCAGCGGGCGCAATGTGCGTTCAAAGATTCGATGAT

Fusarium avenaceum

TCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAAC

CAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTGTTTGTTTTACTCAGAAGTTACAATA

AGAAACATTAGAGTTTGGGTCCTC

AGGTCACATTCAGAAGTTGGGGTTTAACGGCGTGGCCGCGACGATTACCAGTAACGATGTG

TAAATTACTACGCTATGGAAGCTCGACGTGACCGCCAATGTATTTGGGGAGTGCAGCAGGACT

GCAGCTCCCAACACCAAGCTGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCG

Fusarium culmorum

CCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAAT

TCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTT

GAAAGTTTTGATTTATTTGTTTTTTATACTCAGAAGTTCCACTAAAAACAGAGTTTAGGGTTCCT

Hussien T., Yli-Mattila T.

PCR for aflatoxigenic fungi as an alternative way for aflatoxin detection and quantification in developing countries.

В результате исследований секвенсов грибов в сравнении с матрицей грибов, находящихся удалось определить видовой состав патогенов, в базе данных GenBank.

Литераура Forterre P. Where is the root for the universal tree of life / P. Forterre, H. Phillipe // BioEssay, 1999, vol. 21, p. 871–879.

Hillis D. M. Ribosomal DNA: molecular evolution and phylogenetic inference / D. M. Hillis, M. T. Dixon // Q. Rev.

Biol., 1991, vol. 66, p. 411–453.

Hillis D. M. Molecular Systematics / D. M. Hillis, C. Moritz, B. K. Mable (Eds) // Sinauer Ass. Sunderland.- USA, 1996, 655 p.

White T. J. Amplification and direct sequencing of fungal ribosomal DNA genes for phylogenetics / T. J. White, T.

Bruns, S. B. Lee, J. W- Taylor // PCR Protocol a Guide to Methods and Applications.- Academic Press.- 1990, N. Y., p. 315–322.

MOLECULAR GENETIC APPROACHES TO IDENTIFY PATHOGENIC FUNGI OF RASPBERRIES

Julius Khn-Institut (JKI)- Bundesforschungsinstitut fr Kulturpflanzen, Institut fr Zchtungsforschung an gartenbaulichen Kulturen und Obst, Dresden, Germany, vadim.girichev@jki.bund.de This report focuses on the application of molecular methods for identification of fungal species. The ITS region is the most widely sequenced DNA region in fungi and has been useful for molecular systematics at the species level.

Key words: raspberry, pathogens, IST-region.

PCR FOR AFLATOXIGENIC FUNGI AS AN ALTERNATIVE WAY

FOR AFLATOXIN DETECTION AND QUANTIFICATION IN

DEVELOPING COUNTRIES

The most important mycotoxins in areas with hot climate such Egypt are aflatoxins (AFs). Existing detection of the aflatoxigenic fungi are time consuming, labour-intensive, costly, require mycological expertise and facilities. Because most of the people and animals under threat by AFs live in third world, the fast, simple to perform and interpret, and inexpensive methodologies such as PCR is an attractive approach.

Key words: mycotoxins, aflatoxins, Aspergillus flavus, Aspergillus parasiticus, PCR.

AFs are metabolites synthesized by Aspergillus by legislation in many countries because of the toxicity flavus and Aspergillus parasiticus, and are classified and by the EU at 2 µg kg-1 in food for direct human into four types: AFB1, AFB2, AFG1 and AFG2 (Dorner, consumption (Shephard, 2009). AFB1 and total AF 2008). They are highly toxic, carcinogenic, teratogenic (sum of B1, B2, G1 and G2) are set at 5 µg kg–1 and and mutagenic (Oveisi et al., 2007) and considered as 10µg kg–1 respectively for maize (EC 2010).

major etiological factors for hepatocellular carcinoma Aspergillus flavus section grow over a temperature (HCC) (IARC, 2002). In Egypt the incidence of HCC range of 17-42°C but the optimum temperature for has doubled throughout the past decade (Iyer et al., AFs production is 25-35°C. That is why AFB1 is often 2010), while in Kenya death resulting from aflatoxicosis considered as a major contaminant in countries with is reported to increase (Okoth, 2012). AFB1 is regulated hot climate (Cotty and Jaime-Garcia, 2007). Therefore, this compound can be frequently observed in cereals genomic presence of several structural genes involved and other foods or raw materials produced in Egypt in AF biosynthesis does not guarantee the production (El-Tahan et al., 2000). For instance, in a previous of AF by all isolates of A. flavus and A. parasiticus study, 45 isolates of Aspergilli, isolated from soil, seed (Levin, 2012). The AF biosynthesis pathway in several grains (maize, wheat, and peanut) and air, were tested Aspergillus spp. has been very well characterized and for the production of mycotoxins. If fifteen isolates most of the enzymes involved in the biosynthesis were found non toxic, six isolates were of strongly appear to have been identified (Yu et al., 2004). These toxigenic (Moubashor et al., 1977). Oil seed meal and AF biosynthesis pathway genes exist as a gene cluster cereals are considered as the mostly contaminated located in a 70-kb DNA sequence which contains at feed stuffs in Egypt and important economic losses least 25 open reading frames (ORFs) (Yu et al., 2004).

are directly related to the fungal contamination At least 25 genes are involved in the biosynthesis of (rejection of feed with visible fungal growthand AFs and its regulation (Bhatnagar et al., 2006). Several aflatoxin contamination). In another study, the regulators such as aflR and aflJ, involved in the importance of mycotoxigenic Aspergilli in Egyptian pathway are also reported as a part of this cluster (Cary maize from many different regions (Alexandria, et al., 2006). Of this multistep polyketide pathway, Cairo, Giza, El-Beheira, El- Daqahliya, El-Sharqiya, the NOR1 mediates the first committed step in AF Asyut) was evaluated during three years. The most biosynthesis pathway (Chang et al., 1992). Primers common species found were Aspergillus flavus, pertaining to sequences of afl-2, aflD, aflM and aflP, Aspergillus parasiticus, and Penicillium spp. Among (apa-2, nor-2, ver-2, omt-2, respectively) (Shapira et the 88 Aspergillus section flavi strains examined, al., 1996;

Geisen, 1996;

Chen, 2002) have been used to 90% were aflatoxigenic. Around 95% were A. flavus, detect and identify aflatoxigenic strains of A. flavus according to their toxinogenic profile (ability to and A. parasiticus among isolated colonies. Multiplex produce both AFB1 and AFB2 but not AFG1 and G2 RT–PCR containing 4–5 primer pairs of various on YES medium) and molecular analyses. During the combinations of aflD, aflO, aflP, aflQ, aflR and aflS last years, AFB1 contamination was also reported in (aflJ) were used to detect toxigenic fungi (Degola et European production, especially in maize (Pietri et al., al., 2007). PCR methodologies for rare Aspergilli such 2004;

Tabuc et al., 2009). This could be related to the as A. bombycis, A. ochraceoroseus and A. pseudotamar global climatic modifications (Magan et al., 2011). that produce AFs have yet to be developed (Bennett quantification of AFs-producing fungi is due to the In conclusion, lack of reliable multi-mycotoxin fact that AFs are multi-ring structures and therefore analysis hampers research in AFs in developing require a sequence of structural genes for their countries. Although HPLC-MS are available in biosynthesis. That is why there is no specific PCR several research centers and universities most of these marker for any one of the four biologically produced instruments have not been operating due to poor AFs. Unfortunately, the structural genes presently infrastructure and the lack of technical support. So in use for PCR detection of aflatoxigenic fungi are PCR detection and quantification of aflatoxigenic also involved in the synthesis of other fungal toxins fungi are alternative techniques for AFs risk such as sterigmatocystin by Aspergillus versicolor assessment. A lot of work should be done to design and Aspergillus nidulans and therefore lack absolute a specific primer for different AFs types and also for specificity for AF-producing fungi. In addition, the high AFs producers.

References Bennett J. W., Klich M. Mycotoxins // Clin Microbiol Rev., 2003, 26, p. 497–526.

Bhatnagar D, Cary J. W., Ehrlich K., Yu J., Cleveland T. E. Understanding the genetics of regulation of aflatoxin production and Aspergillus flavus development // Mycopathologia, 2006, 262, p. 255–266.

Cary J. W., Ehrlich K. C., Kale S. P., Calvo A. M., Bhatnagar D., Cleveland T. E. Regulatory elements in aflatoxin biosynthesis // Mycotoxin Research, 2006, 22, p. 105–109.

Chang P. K., Skory C. D., Linz J. E. Cloning of a gene associated with aflatoxin B1 biosynthesis in Aspergillus parasiticus // Current Genetics, 1992, 21, p. 231–233.

Chen R. S., Tsay J. G., Huang Y. F., Chiou R. Y. Polymerase chain reaction-mediated characterization of molds belonging to the Aspergillus flavus group and detection of Aspergillus parasiticus in peanut kernels by a multiplex polymerase chain reaction // J. of Food Protection, 2002, 65, p. 840–844.

Cotty P. J., Jaime-Garcia R. Influence of climate on aflatoxin producing fungi and aflatoxin contamination // Inter. J.

of Food Microbiol., 2007, 119, p. 109–115.

Degola F., Berni E., Dall’Asta C., Spotti E., Marchelli R., Ferrero I., Restivo F. M. A multiplex RT-PCR approach to detect aflatoxigenic strains of Aspergillus flavus // J. of Applied Microbiol., 2007, 203, p. 409–427.

Dorner J. W. Management and prevention of mycotoxins in peanuts // Food Additives and Contaminants. Part A Khodaparast S. A.

Invasive pathogens in the North of Iran: new epidemics caused by aggressive fungal pathogens in the 21th century.

Chem. Anal. Control Expo. Risk Assess, 2008, 25, p. 203–208.

EC, European Commission. Commission Regulation (EC) No. 165/2010, of 26 February 2010 amending Regulation (EC) No 1881/2006 setting maximum levels for certain contaminants in foodstuffs as regards Aflatoxins. Official Journal of the European Union, 2010, 50, p. 11–12.

El-Tahan F. H., El-Tahan M. H., Shebl M. A. Occurrence of aflatoxins in cereal grains from four egyptian governorates // Nahrung, 2000, 44, p. 279–280.

Geisen R. Multiplex polymerase chain reaction for the detection of potential aflatoxin and sterigmatocystin producing fungi // Systematic and Applied Microbiol., 1996, 29, p. 388–392.

IARC, (International Agency for Research on Cancer). Some traditional herbal medicines: Some mycotoxins, naphthalene and styrene. IARC Monograph on the Evaluation of Carcinogenic Risks to Humans, World Health Organization, Lyon, France, 2002, 82, p. 1–556.

Iyer P., Zekri A., Hung C., Schiefelbein E., Ismail K., Hablas A., Seifeldin I. A. and Soliman A. S. Concordance of DNA methylation pattern in plasma and tumor DNA of Egyptian hepatocellular carcinoma patients // Experim. and Molecular Pathology, 2010, 88, p. 107–111.

Levin Robert E. PCR detection of aflatoxin producing fungi and its limitations // Intern. J. of Food Microbiology, 2012, 156, p. 1–6.

Magan N., Medina A., Aldred A. Possible climate change effects on mycotoxin contamination of food crops pre- and post harvest // Plant Pathology, 2011, 60, p. 150–163.

Moubashor A. H., El-Kady I. A., Shoriet A. Toxigenic Aspergilli isolated from different sources in Egypt // Annales de la nutrition et de l'alimentation, 1977, 31, p. 607–615.

Okoth S., Nyongesa B., Ayugi V., Kang’ethe E., Korhonen H., Joutsjoki V. Toxigenic Potential of Aspergillus Species Occurring on Maize Kernels from Two Agro-Ecological Zones in Kenya // Toxins, 2012, 4, p. 991–100.

Oveisi M. R., Jannat B., Sadeghi N., Hajimahmoodi M., Nikzad A. Presence of aflatoxin M1 in milk and infant milk products in Tehran, Iran // Food Control, 2007, 18, p. 1216–1218.

Pietri A., Bertuzzi T., Pallaroni L., Piva G. Occurrence of mycotoxins and ergosterol in maize harvested over 5 years in northern Italy // Food Additives and Contaminants, 2004, 21, p. 479–487.

Shapira R., Paster N., Eyal O., Menasherov M., Mett A., Salomon R. Detection of aflatoxigenic molds in grains by PCR // Applied and Environ. Microbiol., 1996, 62, p. 3270–3273.

Shephard G. S. Aflatoxin analysis at the beginning of the twenty-first century / Analytical and Bioanalytical Chemistry, 2009, 395, p. 1215–1224.

Tabuc C., Marin D., Guerre P., Sesan T., Bailly J. D. Mold and Mycotoxin Content of Cereals in South-East Romania // J. of Food Protection, 2009, 72, p. 662–665.

Yu J., Bhatnagar D., Cleveland T. E. Completed sequence of aflatoxin pathway gene cluster in Aspergillus parasiticus // FEBS Letters, 2004, 564, p. 126–130.

Yu J., Chang P. K., Ehrlich K. C., Cary J. W., Bhatnagar D., Cleveland T. E., Payne G. A., Linz J. E., Woloshuk C.

P., Bennett J. W. Clustered pathway genes in aflatoxin biosynthesis // Applied and Environ. Microbiol., 2004, 70, p. 1253–1262.

INVASIVE PATHOGENS IN THE NORTH OF IRAN:

NEW EPIDEMICS CAUSED BY AGGRESSIVE FUNGAL

PATHOGENS IN THE 21TH CENTURY

Guilan and Mazandaran, provinces in the North of Iran, lies along the Caspian Sea. This region is separated from other parts of Iran by the Alborz mountain range. This region has a humid temperate and Mediterranean like climate with abundant annual rainfall (known as temperate Khazar weather). Maximum rainfall recorded from Guilan province, was 1590. 60 mm for the year 2007 (Anonymous, 2008). Some forest stands in this region such as chestnut (Castanea sativa Mill.) and box tree (Buxus sempervirens L.) stands are unique in having native trees and there are no records of natural or cultivated such trees outside of north of Iran, except for some individual trees cultivated around the country (V. Mozaffarian, 2005).

During recent years, these unique stands have in current year (M. Mirabolfathy, 2013). Interestingly, been affected by aggressive fungal species, the such epidemics have also been identified relatively fungus Cryphonectria parasitica on chestnut trees and recently in the UK as it was first described in the Calonectria pseudonaviculata (Crous, J. Z. Groenew mid 1990s as an introduced species causing a sever & C. F. Hill) L. Lombard, M. J. WingF. & Crous on shoot blight of boxwood (B. Henricot et al., 2000).

box tree. There are several examples for introduction Moreover, report of this fungus have since come from and spread of new plant pathogens around the world, Belgium, Ireland, Germany, and the Netherlands, which some of them have been known to cause Italy, Austria and Spain suggesting that it spread from biological invasions. Some of the most familiar to plant the UK to mainland Europe (S. M. Douglas, 2012). In pathologist are potato blight (Phytophthora infestans United States boxwood blight is a new plant disease, (Mont.) de Bary) in Europe in the 19th century, and has first been confirmed in the October, chestnut blight in US and Europe in the 20th century, (S. M. Douglas, 2012). There is no evidence when where they caused serious damage to crop production and how such fungal pathogens introduced to the and in some cases eradication of plant species in country and such epidemics have happened. One parts of the world. Cryphonectria parasitica (Murrill) suggestion is that both fungal species introduced from M. E. Barr, is the most notorious species, responsible Europe (Turkey or Azerbaijan republic). However, for devastating damage to Castanea species in Europe the Chines origin of Cryphonectria parasitica has (Castanea sativa) and the United States (Castanea also been suggested, because during recent years dentata Sudw.). It was first reported in 1904 in the import of chestnut from China is common and such United States and caused severe damage to American nut are available at markets. By the way, some local chestnuts during the last century (G. L. Griffin, 1986;

farmer used such nut for producing seedlings around S. L. Anagnostakis, 1987). Cryphonectria parasitica the Guilan province. However, further studies are is the most destructive fungus for C. sativa in most required to understanding the origin of these fungi.

growing regions in Europe and caused significant Disease management strategies in forest are more problems when it arrived (R. Locci, 2003). Chestnut complicated especially against aggressive pathogens blight has been reported from Guilan province in and the main procedures should focus to prevent Iran in 2006 (Kazempour et al., 2006). There are no entry or spread of dangerous pathogens using reliable previous records of these fungal diseases on above procedures including continued forest inspection and mentioned plant species. Hence, it seems these disease appropriate quarantine system. To aim this, much outbreaks were, most probably, the results of new information on pathogens presenting a risk to the pathogen introduction to the country. Apparently, country is required and might be collected by the the introduction of box blight fungus to north of related organization.

Iran has happened even more recently, so that the Key words: Cylindrocladium, disease, epidemiology, pathogen was first reported to cause severe epidemics forest.

References Anagnostakis S. L. Chestnut blight: the classical problem of an introduced pathogen. Mycologia, 1987, 79, p. 23–37.

Anonymous. Meteorological Year Book for 2007. Ministry of Road and Transportation, I. R. of Iran, Meteorological Organization (IRIMO), Tehran, 2008, 660 p.

CABI/EPPO. Cylindrocladium buxicola Henricot. Distribution Maps of Plant Diseases, 2007, 996, p. 1–2.

Douglas S. M. Boxwood blight: a new disease for Connecticut and the US. The Connecticut Agricultural Experiment Station. Published on the Internet http://www. ct. gov (accessed on January 2008).

Griffin G. J. Chestnut blight and its control. Hortic. Rev., 1986, 8, p. 291–336.

Henricot B., Perez Sierra A., Prior C. A new blight disease on Buxus in the UK caused by the fungus Cylindrocladium.

Plant Pathology, 2000, 49, p. 805.

Kazempour M. N., Khodaparast S. A., Arefipour M., Salehi M., Amanzadeh B., Ramzanie M., Shirazi B. K. Occurrence of Cryphonectria parasitica the causal agent of chestnut blight in Iran. Plant Pathol., 2006, 55, p. 815.

Locci R. Chestnut blight: an epidemic checked by biological control. Friulian J. Sci., 2003, 4, p. 27–45.

Mirabolfathy M., Ahangaran Y., Lombard L., Crous P. Leaf blight of Buxus sempervirens in northern forests of Iran caused by Calonectria pseudonaviculata. Plant disease, 2013, http://dx. doi. org/10. 1094/PDIS-03-13-0237-PDN.

MozaffarianV. Trees and Shrubs of Iran. Tehran, Iran: Farhang Moaser Publication, 2005, 1004 p.

Kosman E. Diversity analysis in plant pathology.

DIVERSITY ANALYSIS

IN PLANT PATHOLOGY

Changes that plant pathogen populations undergo in time and space in response to various climatic and ecological environments, to variable genetic background of host plants, or to different management systems of crops cultivation and disease control are often studied through analysis of genetic relationships among operational units of the plant pathogen. Better understanding the genetic structure of a pathogen population is essential to accurately evaluate risks related to pathogen evolution and plant-pathogen interaction, and to improve programs and strategies of breeding for durable disease resistance. If genetic structure is defined as the amount and distribution of genetic variation within and among populations, then reliable assessment of that variation is key to determining relevance and validity of research results and practical disease management recommendations.

Making inferences about variation within and development of such coefficients of dissimilarity among various operational units in general and, in is the separate challenging problem that might be particular, in plant pathology may depend considerably quite complicated (Kosman, Leonard, 2005). The on ability of an approach applied to diversity analysis dissimilarity based methods assess actually functional to utilize correctly and in full extent information diversity because each individual is expressed by its available in the raw data. Therefore, it is essential functional profile in the space of the selected traits, to select a suitable approach to measuring diversity and these approaches are also applicable to measuring in each specific study. Comprehensive analysis of complex diversity for combinations of several groups the commonly used frequency-based genotypic and of descriptors of different types. New approach gene methods, as well as recently developed methods of ‘true diversity’ (Jost, 2007, 2008;

Tuomisto, 2010a, 2010b) and functional diversity (Petchey, Gaston, Mathematical validity of the average based methods 2006;

Pavoine, 2012) demonstrated both hidden and depends on the selected dissimilarity measure, whereas obvious limitations and possible inconsistency of the assignment based approaches are always valid.

these approaches in analyzing population diversity Finally, the assignment based methods are able to and structure. The proposed dissimilarity based address shortcomings of the commonly used measures methods (Kosman, Leonard, 2007) can be separated of population diversity, and they are preferable in the into two groups according to the mode of dealing case of possible association between traits. In light with a matrix of pairwise dissimilarities between of these properties of dissimilarity based methods, it individuals. The first group includes methods based becomes clear that they may serve as universal tools on averaging pairwise dissimilarities. Many commonly for diversity analysis, which completely depend used diversity parameters can be explained in terms of on a proper assessment of dissimilarity between the average based measures (Kosman, 2003;

Kosman, elementary individual units.

Leonard, 2007). Methods from the second group are User friendly software for calculating various based on a solution of the corresponding assignment genotypic, gene and genetic diversity parameters problem (Kosman, 1996). Prior to analyzing diversity has been recently developed (Kosman et al., 2008;

of various systems, the dissimilarity based approaches Schachtel et al., 2012).

need a suitable assessment of dissimilarity between Acknowledgements: I am deeply indebted to the corresponding individual operational units ProF. Kurt Leonard (University of Minnesota) (individuals, communities, populations, clusters, who focused my attention on problems of diversity functions, phylogenetic trees etc.). Choice or analysis in the mid-1990s.

References Jost L. Partitioning diversity into independent alpha and beta components. Ecology, 2007, 88, p. 2427-2439.

Jost L. GST and its relatives do not measure differentiation. Molecular Ecology, 2008, 17, р. 4015-4026.

Kosman E. Difference and diversity of plant pathogen populations: a new approach for measuring. Phytopathology, 1996, 86, р. 1152–1155.

Kosman E. Nei’s gene diversity and the index of average differences are identical measures of diversity within populations. Plant Pathology, 2003, 52, р. 533–535.

Kosman E., Dinoor A., Herrmann A. & Schachtel G. A. Virulence Analysis Tool (VAT). User Manual. Available online, 2008.

http://www. tau. ac. il/lifesci/departments/plant_s/members/kosman/VAT. html.

Kosman E. & Leonard K. J. Similarity coefficients for molecular markers in studies of genetic relationships between individuals for haploid, diploid, and polyploid species. Molecular Ecology, 2005, 14, р. 415-424.

Kosman E. & Leonard K. J. Conceptual analysis of methods applied to assessment of diversity within and distance between populations with asexual or mixed mode of reproduction. New Phytologist, 2007, 174, р. 683–696.

Pavoine S. Clarifying and developing analyses of biodiversity: towards a generalisation of current approaches. Methods in Ecology and Evolution, 2012, 3, р. 509–518.

Petchey O. L. & Gaston K. J. Functional diversity: Back to basics and looking forward. Ecology Letters, 2006, 9, р.

741–758.

Schachtel G. A., Dinoor A., Herrmann A. & Kosman E. Comprehensive evaluation of virulence and resistance data: A new analysis tool. Plant Disease, 2012, 96, р. 1060–1063.

Tuomisto H. A diversity of beta diversities: straightening up a concept gone awry. Part 1. Defining beta diversity as a function of alpha and gamma diversity. Ecography, 2010a, 33, р. 2–22.



Pages:     | 1 |   ...   | 18 | 19 || 21 |
 




Похожие материалы:

«Министерство сельского хозяйства Российской Федерации Российская академия сельскохозяйственных наук Государственное научное учреждение Всероссийский научно-исследовательский институт электрификации сельского хозяйства (ГНУ ВИЭСХ) Московский государственный агроинженерный университет им. В.П. Горячкина (МГАУ) Государственное научное учреждение Всероссийский научно-исследовательский институт механизации сельского хозяйства (ГНУ ВИМ) ЭНЕРГООБЕСПЕЧЕНИЕ И ЭНЕРГОСБЕРЕЖЕНИЕ В СЕЛЬСКОМ ХОЗЯЙСТВЕ ...»

«Российская академия сельскохозяйственных наук Министерство сельского хозяйства Российской Федерации Государственное научное учреждение Всероссийский научно-исследовательский институт электрификации сельского хозяйства (ГНУ ВИЭСХ) Московский государственный агроинженерный университет им. В.П. Горячкина (МГАУ) ФГНУ Российский научно-исследовательский институт информации и технико-экономических исследований по инженерно-техническому обеспечению АПК (ФГНУ РОСИНФОРМАГРОТЕХ) ЭНЕРГООБЕСПЕЧЕНИЕ И ...»

«Российская академия сельскохозяйственных наук Министерство сельского хозяйства Российской Федерации Государственное научное учреждение Всероссийский научно-исследовательский институт электрификации сельского хозяйства (ГНУ ВИЭСХ) Московский государственный агроинженерный университет им. В.П. Горячкина (МГАУ) ФГНУ Российский научно-исследовательский институт информации и технико-экономических исследований по инженерно-техническому обеспечению АПК (ФГНУ РОСИНФОРМАГРОТЕХ) ЭНЕРГООБЕСПЕЧЕНИЕ И ...»

«Российская академия сельскохозяйственных наук Министерство сельского хозяйства Российской Федерации Государственное научное учреждение Всероссийский научно-исследовательский институт электрификации сельского хозяйства (ГНУ ВИЭСХ) Московский государственный агроинженерный университет им. В.П. Горячкина (МГАУ) ФГНУ Российский научно-исследовательский институт информации и технико-экономических исследований по инженерно-техническому обеспечению АПК (ФГНУ РОСИНФОРМАГРОТЕХ) ЭНЕРГООБЕСПЕЧЕНИЕ И ...»

«Российская академия сельскохозяйственных наук Министерство сельского хозяйства Российской Федерации Государственное научное учреждение Всероссийский научно-исследовательский институт электрификации сельского хозяйства (ГНУ ВИЭСХ) Московский государственный агроинженерный университет им. В.П. Горячкина (МГАУ) ФГНУ Российский научно-исследовательский институт информации и технико-экономических исследований по инженерно-техническому обеспечению АПК (ФГНУ РОСИНФОРМАГРОТЕХ) Открытое акционерное ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ РОССИЙСКАЯ АКАДЕМИЯ СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК ВСЕРОССИЙСКИЙ НАУЧНО-ИССЛЕДОВАТЕЛЬСКИЙ ИНСТИТУТ АГРОХИМИИ им. Д. Н. ПРЯНИШНИКОВА ПОЧВЕННЫЙ ИНСТИТУТ им. В. В. ДОКУЧАЕВА УТВЕРЖДАЮ УТВЕРЖДАЮ Министр сельского хозяйства Президент Российской академии Российской Федерации сельскохозяйственных наук _А. В. Гордеев _Г. А. Романенко 24 сентября 2003 г. 17 сентября 2003 г. МЕТОДИЧЕСКИЕ УКАЗАНИЯ ПО ПРОВЕДЕНИЮ КОМПЛЕКСНОГО МОНИТОРИНГА ПЛОДОРОДИЯ ПОЧВ ...»

«МЕЛИОРАЦИЯ: ЭТАПЫ И ПЕРСПЕКТИВЫ РАЗВИТИЯ Материалы международной научно- производственной конференции Москва 2006 РОССИЙСКАЯ АКАДЕМИЯ СЕЛЬСКОХОЗЯЙСТВЕННЫХ НАУК Государственное научное учреждение Всероссийский научно-исследовательский институт гидротехники и мелиорации имени А.Н.Костякова МЕЛИОРАЦИЯ: ЭТАПЫ И ПЕРСПЕКТИВЫ РАЗВИТИЯ Материалы международной научно-производственной конференции, посвященной 40-летию начала осуществления широкомасштабной программы мелиорации Москва 2006 УДК 631.6 М 54 ...»

«ПЧЕЛОВОДСТВО А.Г МЕГЕДЬ В.П. ПОЛИЩУК Допущено Государственным агропромышленным комитетом Украинской ССР в качестве учебника для средних специальных учебных заведений по специальностям Пчеловодство и Зоотехния Киев Выща школа 1990 ББК 46.91я723 М41 УДК 638.1(075.3) Рецензенты: преподаватель М. И. Совкунец (Борзнянский совхоз-техникум Черни говской области), И. Ф. Доля (заведующий пчелофермой Республиканского учеб но-производственного комбината по пчеловодству) Переведено с издания: Мегедь О. Г., ...»

«Санкт-Петербургский государственный университет. Институт наук о Земле ГНУ Центральный музей почвоведения им. В.В. Докучаева ГНУ Почвенный институт им. В.В. Докучаева Фонд сохранения и развития научного наследия В.В. Докучаева Общество почвоведов им. В.В. Докучаева МАТЕРИАЛЫ Международной научной конференции XVII Докучаевские молодежные чтения посвященной 110-летию Центрального музея почвоведения им. В.В. Докучаева НОВЫЕ ВЕХИ В РАЗВИТИИ ПОЧВОВЕДЕНИЯ: СОВРЕМЕННЫЕ ТЕХНОЛОГИИ КАК СРЕДСТВА ПОЗНАНИЯ ...»

«Санкт-Петербургский государственный университет ГНУ Центральный музей почвоведения им. В.В. Докучаева Россельхозакадемии ГНУ Почвенный институт им. В.В. Докучаева Россельхозакадемии Фонд сохранения и развития научного наследия В.В. Докучаева Общество почвоведов им. В.В. Докучаева МАТЕРИАЛЫ Международной научной конференции XVI Докучаевские молодежные чтения посвященной 130-летию со дня выхода в свет книги Русский чернозем В.В. Докучаева ЗАКОНЫ ПОЧВОВЕДЕНИЯ: НОВЫЕ ВЫЗОВЫ 4– 6 марта 2013 года ...»

«Санкт-Петербургский государственный университет ГНУ Центральный музей почвоведения им. В.В. Докучаева Россельхозакадемии ГНУ Почвенный институт им. В.В. Докучаева Россельхозакадемии Фонд сохранения и развития научного наследия В.В. Докучаева Общество почвоведов им. В.В. Докучаева МАТЕРИАЛЫ Международной научной конференции XV Докучаевские молодежные чтения посвященной 150-летию со дня рождения Р.В. Ризположенского ПОЧВА КАК ПРИРОДНАЯ БИОГЕОМЕМБРАНА 1– 3 марта 2012 года Санкт-Петербург ...»

«Санкт-Петербургский государственный университет ГНУ Центральный музей почвоведения им. В.В. Докучаева Россельхозакадемии ГНУ Почвенный институт им. В.В.Докучаева Россельхозакадемии Фонд сохранения и развития научного наследия В.В. Докучаева Общество почвоведов им. В.В. Докучаева МАТЕРИАЛЫ Всероссийской научной конференции XIV Докучаевские молодежные чтения посвященной 165-летию со дня рождения В.В.Докучаева ПОЧВЫ В УСЛОВИЯХ ПРИРОДНЫХ И АНТРОПОГЕННЫХ СТРЕССОВ 1– 4 марта 2011 года Санкт-Петербург ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ ДЕПАРТАМЕНТ НАУЧНО-ТЕХНОЛОГИЧЕСКОЙ ПОЛИТИКИ И ОБРАЗОВАНИЯ САНКТ-ПЕТЕРБУРГСКАЯ ГОСУДАРСТВЕННАЯ АКАДЕМИЯ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ СЕВЕРО-ЗАПАДНАЯ ВЕТЕРИНАРНАЯ АССОЦИАЦИЯ МАТЕРИАЛЫ МЕЖДУНАРОДНОЙ НАУЧНОЙ КОНФЕРЕНЦИИ СТУДЕНТОВ, АСПИРАНТОВ И МОЛОДЫХ УЧЕНЫХ ЗНАНИЯ МОЛОДЫХ ДЛЯ РАЗВИТИЯ ВЕТЕРИНАРНОЙ МЕДИЦИНЫ И АПК СТРАНЫ Санкт-Петербург 2012 1 УДК: 619 (063) Материалы международной научной конференции студентов, аспи рантов и молодых ученых Знания ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА И ПРОДОВОЛЬСТВИЯ РЕСПУБЛИКИ БЕЛАРУСЬ УЧРЕЖДЕНИЕ ОБРАЗОВАНИЯ ГРОДНЕНСКИЙ ГОСУДАРСТВЕННЫЙ АГРАРНЫЙ УНИВЕРСИТЕТ МАТЕРИАЛЫ ХІІ МЕЖДУНАРОДНОЙ СТУДЕНЧЕСКОЙ НАУЧНОЙ КОНФЕРЕНЦИИ (Гродно, 18-20 мая 2011 года) В ТРЕХ ЧАСТЯХ ЧАСТЬ 3 АГРОНОМИЯ ЗАЩИТА РАСТЕНИЙ ЗООТЕХНИЯ ВЕТЕРИНАРИЯ ТЕХНОЛОГИЯ ХРАНЕНИЯ И ПЕРЕРАБОТКИ ОБЩЕСТВЕННЫЕ НАУКИ К 60-летию вуза Гродно УО ГГАУ УДК 63 (06) ББК М Материалы ХІІ Международной студенческой научной конференции. – Гродно, 2011. – ...»

«Казанский (Приволжский) федеральный университет Общество почвоведов им. В.В. Докучаева Институт проблем экологии и недропользования АН РТ НАСЛЕДИЕ И.В. ТЮРИНА В СОВРЕМЕННЫХ ИССЛЕДОВАНИЯХ В ПОЧВОВЕДЕНИИ Материалы международной научной конференции Казань, 15-17 октября 2013 г. И.В.Тюрин (1892-1962) Казань 2013 УДК 631.4 ББК 40.3 Печатается по решению Ученого совета Института фундаментальной медицины и биологии ФГБОУ ВПО Казанский (Приволжский) федеральный университет Наследие И.В. Тюрина в ...»

«ISSN 1561-1124 МАТЕРИАЛЫ ПО ИЗУЧЕНИЮ РУССКИХ ПОЧВ ВЫПУСК 7 (34) Издательство Санкт-Петербургского университета 2012 САНКТ-ПЕТЕРБУРГСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ КАФЕДРА ПОЧВОВЕДЕНИЯ И ЭКОЛОГИИ ПОЧВ ЦЕНТРАЛЬНЫЙ МУЗЕЙ ПОЧВОВЕДЕНИЯ ИМ. В.В.ДОКУЧАЕВА МАТЕРИАЛЫ ПО ИЗУЧЕНИЮ РУССКИХ ПОЧВ ВЫПУСК 7 (34) Издание основано в 1885 г. А.В. Советовым и В.В. Докучаевым Издательство С.-Петербургского университета 2012 УДК 631.4 ББК 40.3 М34 Редакционная коллегия: Б.Ф. Апарин (председатель), Е.В. Абакумов, ...»

«ISSN 1561-1124 МАТЕРИАЛЫ ПО ИЗУЧЕНИЮ РУССКИХ ПОЧВ ВЫПУСК 6 (33) Издательство Санкт-Петербургского университета 2009 САНКТ-ПЕТЕРБУРГСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ КАФЕДРА ПОЧВОВЕДЕНИЯ И ЭКОЛОГИИ ПОЧВ ЦЕНТРАЛЬНЫЙ МУЗЕЙ ПОЧВОВЕДЕНИЯ ИМ. В.В.ДОКУЧАЕВА МАТЕРИАЛЫ ПО ИЗУЧЕНИЮ РУССКИХ ПОЧВ ВЫПУСК 6 (33) Издание основано в 1885 г. А.В. Советовым и В.В. Докучаевым Издательство С.-Петербургского университета 2009 УДК 631.4 + 577.34 ББК 40.3 М34 Редакционная коллегия: И.А. Горлинский (председатель), Б.Ф. ...»

«X ДАЛЬНЕВОСТОЧНАЯ КОНФЕРЕНЦИЯ ПО ЗАПОВЕДНОМУ ДЕЛУ МАТЕРИАЛЫ КОНФЕРЕНЦИИ 25-27 сентября 2013 г. г. Благовещенск АМУРСКИЙ ФИЛИАЛ БОТАНИЧЕСКОГО САДА-ИНСТИТУТА ДВО РАН АМУРСКИЙ ФИЛИАЛ WWF РОССИИ БЛАГОВЕЩЕНСКИЙ ГОСУДАРСТВЕННЫЙ ПЕДАГОГИЧЕСКИЙ УНИВЕРСИТЕТ РОССИЙСКИЙ ФОНД ФУНДАМЕНТАЛЬНЫХ ИССЛЕДОВАНИЙ АМУРСКОЕ ОТДЕЛЕНИЕ СОЦИАЛЬНО-ЭКОЛОГИЧЕСКОГО СОЮЗА АМУРСКОЕ ОТДЕЛЕНИЕ РУССКОГО БОТАНИЧЕСКОГО ОБЩЕСТВА СОВЕТ МОЛОДЫХ УЧЕНЫХ АФ БСИ ДВО РАН X ДАЛЬНЕВОСТОЧНАЯ КОНФЕРЕНЦИЯ ПО ЗАПОВЕДНОМУ ДЕЛУ 25-27 сентября ...»

«МИНИСТЕРСТВО СЕЛЬСКОГО ХОЗЯЙСТВА РОССИЙСКОЙ ФЕДЕРАЦИИ ФГОУ ВПО УЛЬЯНОВСКАЯ ГОСУДАРСТВЕННАЯ СЕЛЬСКОХОЗЯЙСТВЕННАЯ АКАДЕМИЯ ТЕХНОЛОГИЧЕСКИЙ ИНСТИТУТ – ФИЛИАЛ ФГОУ ВПО УЛЬЯНОВСКАЯ ГОСУДАРСТВЕННАЯ СЕЛЬСКОХОЗЯЙСТВЕННАЯ АКАДЕМИЯ МАТЕРИАЛЫ IX МЕЖДУНАРОДНОЙ СТУДЕНЧЕСКОЙ НАУЧНО-ПРАКТИЧЕСКОЙ КОНФЕРЕНЦИИ С МЕЖДУНАРОДНЫМ УЧАСТИЕМ 31 марта 2011 Димитровград 2011 г. УДК 631 Редакционная коллегия: Главный редактор Х.Х. Губейдуллин Научный редактор Т.А. Мащенко Редакционная коллегия И.И. Шигапов А.М. Кадырова ...»






 
© 2013 www.seluk.ru - «Бесплатная электронная библиотека»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.